Introduction
The focus of this week's lab is the first aspect of the Central Dogma of molecular biology: replication. DNA replication is a fundamental natural process that occurs in the duplication of all cells. However, like many other natural processes in cells, molecular biologists have co-opted components of the process of replication to create biotechnological tools. In particular, modifications of DNA replication form the core of both automated DNA sequencing and the polymerase chain reaction (PCR), two techniques that have revolutionized molecular biology as well as other diverse fields including forensics, biomedical research, cell biology, genetics, ecology, and evolution.
The linear organization of DNA, its complementary bases, and the relatively weak hydrogen bonds between them are crucial features that allow DNA to be replicated. In the replication process the DNA molecule is "unzipped" down the middle by enzymes that break the hydrogen bonds between the two strands. This exposes the center of the molecule to the action of other enzymes that create complementary strands of DNA. Since the structure of DNA is the same for all living organisms, the general principles involved in DNA replication apply to organisms ranging from bacteria through eukaryotes (including vertebrates). However, because the genomes of eukaryotes are larger and more complex than bacteria, the replication process in eukaryotes is also more complex. You will learn more details of this complexity in BSCI 110 lecture - in lab we will focus on the generic requirements for replicating DNA in general.
"Unzipping" DNA
Double-stranded DNA cannot be replicated until the two complementary strands have been separated. Separating the strands is relatively easy because the hydrogen bonds between the bases are weak in comparison to the covalent bonds in the rest of the molecule. In living cells, the enzyme helicase is used to separate the strands starting at a specific location in the genome where replication will begin. Helicase uses energy from ATP hydrolysis to break the hydrogen bonds between the bases. In vitro, it is possible instead to separate the strands by heating the DNA to the point where the kinetic energy of the system is great enough to break the hydrogen bonds. Because of the similarity between this process and the breaking of hydrogen bonds when ice turns to liquid water, this process is sometimes referred to as "melting" the DNA. However, the temperature required to melt the DNA is relatively high: about 95˚C. This is higher than the temperature that most enzymes can sustain without becoming denatured, which introduces challenges in using this technique as a part of an enzyme-based artificial replication system.
Replicating DNA
Fig. 1. Extension of a replicated DNA strand by DNA polymerase. Image modified from a diagram by Madeleine Ball, Wikipedia Commons, used under a CC-Attribution-ShareAllike license
In living cells, an enzyme called DNA polymerase extends a growing DNA strand by attaching nucleotides that are complementary to the template strand (Fig. 1). Because of the universal nature of DNA, DNA from any source can be replicated in vitro by a suitable DNA polymerase even if that enzyme is from a different organism.
DNA polymerase requires raw materials to construct the strand that is complementary to the template. Complementary deoxynucleoside triphosphates (dNTPs; A, T, G, or C) present in the reaction mixture are linked by polymerase to the 3' end of the growing strand.
Primers
Extension of the growing replicated DNA strand occurs only in the 5' to 3' direction and polymerase is only able to add nucleotides to the 3' end of an existing strand. In living cells, an enzyme attaches a small piece of RNA, which serves as a primer, to the template strand. Polymerase then extends the DNA strand that is complementary to the template and the RNA primer is later removed.
When DNA is replicated in vitro (as a part of sequencing or PCR), oligonucleotides (small single stranded pieces of DNA that are complementary to the template strand) are used as the primers at the desired location for the start of replication. These primers can be synthesized commercially and can have any specified sequence. This allows a molecular biologist to choose the segment of DNA to be replicated by creating a primer that is complementary to the desired starting location (assuming that the DNA sequence of the starting location is known).
You can test primers using "virtual PCR" at http://biocompute.bmi.ac.cn/CZlab/MFEprimer-2.0/
For reference purposes, the sequences of the actual primers we are using in the experiment are:
Exon 6-1 primer:
GGGCTGGGAATGATTTG
Exon 6-2 primer:
GGTGTCCCCCTCCTGCTATC
